Review



reverse primer  (tiangen biotech co)


Bioz Verified Symbol tiangen biotech co is a verified supplier
Bioz Manufacturer Symbol tiangen biotech co manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    tiangen biotech co reverse primer
    Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 362 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pmc13019757-148-71-77?v=tiangen+biotech+co
    Average 99 stars, based on 362 article reviews
    reverse primer - by Bioz Stars, 2026-07
    99/100 stars

    Images



    Similar Products

    universal reverse pcr primer  (Servicebio Inc)
    86
    Servicebio Inc universal reverse pcr primer
    Universal Reverse Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pmc13145395-9-2-7?v=Servicebio+Inc
    Average 86 stars, based on 1 article reviews
    universal reverse pcr primer - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    htrac hdr genomic reverse primer targeting rha  (Eurofins)
    86
    Eurofins htrac hdr genomic reverse primer targeting rha
    Htrac Hdr Genomic Reverse Primer Targeting Rha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pmc13265900-95-0-9?v=Eurofins
    Average 86 stars, based on 1 article reviews
    htrac hdr genomic reverse primer targeting rha - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    reverse primers  (Sangon Biotech)
    86
    Sangon Biotech reverse primers
    Reverse Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pm42276401-117-20-24?v=Sangon+Biotech
    Average 86 stars, based on 1 article reviews
    reverse primers - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    reverse primers  (Eurofins)
    86
    Eurofins reverse primers
    Reverse Primers, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pm42268715-402-22-27?v=Eurofins
    Average 86 stars, based on 1 article reviews
    reverse primers - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    gaatgccaccttcatccgagaag reverse  (OriGene)
    94
    OriGene gaatgccaccttcatccgagaag reverse
    Gaatgccaccttcatccgagaag Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pm42234557-282-119-122?v=OriGene
    Average 94 stars, based on 1 article reviews
    gaatgccaccttcatccgagaag reverse - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    gcgacatactcaagcaggagca reverse  (OriGene)
    94
    OriGene gcgacatactcaagcaggagca reverse
    Gcgacatactcaagcaggagca Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pm42234557-282-130-133?v=OriGene
    Average 94 stars, based on 1 article reviews
    gcgacatactcaagcaggagca reverse - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    tcgcctccaactcaagctggtt reverse  (OriGene)
    94
    OriGene tcgcctccaactcaagctggtt reverse
    Tcgcctccaactcaagctggtt Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pm42234557-282-97-100?v=OriGene
    Average 94 stars, based on 1 article reviews
    tcgcctccaactcaagctggtt reverse - by Bioz Stars, 2026-07
    94/100 stars
    		  Buy from Supplier
    reverse primer  (tiangen biotech co)
    99
    tiangen biotech co reverse primer
    Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pmc13019757-148-71-77?v=tiangen+biotech+co
    Average 99 stars, based on 1 article reviews
    reverse primer - by Bioz Stars, 2026-07
    99/100 stars
    		  Buy from Supplier
    n a htrac hdr genomic reverse primer targeting rha  (Eurofins)
    86
    Eurofins n a htrac hdr genomic reverse primer targeting rha
    N A Htrac Hdr Genomic Reverse Primer Targeting Rha, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/10__1016_slash_j__isci__2026__116175-216-48-57?v=Eurofins
    Average 86 stars, based on 1 article reviews
    n a htrac hdr genomic reverse primer targeting rha - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier
    primer  (tiangen biotech co)
    99
    tiangen biotech co primer
    Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/reverse+primers/pmc13010918-87-22-17?v=tiangen+biotech+co
    Average 99 stars, based on 1 article reviews
    primer - by Bioz Stars, 2026-07
    99/100 stars
    		  Buy from Supplier

    Image Search Results